Table 1

PCR and sequencing primers

GeneForward primerReverse primer Size (bp)
Chicken H-rasTCAGCTGGAAGATGACCGAGTTTGTGGGGTCGTACTCATCAA114
Turkey K-rasCGCCGGGCAGGTCTGCTAAAAAGAGACAGGTTTCCCCATCAA174
P53-1GCGGAGGAGATGGAACCATTGGGGGAGTAAGTGCAGGTGACC332
P53-2CCCATCCACGGAGGATTATGGGGTCTCGTCGTCGTGGTAACG342
P53-3GCCGTGGCCGTCTATAAGAAACGGAAGTTCTCCTCCTCGATC396
P53-4CCTCACCATCCTTACACTGGAGGTCCCTCCACCTTCACACGG319
P53-5GCTGAACCCCGACAATGAGATGCGTGGCTAAAGGAAAAAGGG222