Table 1.

Mouse primer sets used for real-time quantitative PCR

Gene nameSequence (forward/reverse, 5′→3′)
Nos2CTATGGCCGCTTTGATGTGC/TTGGGATGCTCCATGGTCAC
TnfCCCACTCTGACCCCTTTACT/TTTGAGTCCTTGATGGTGGT
Il1bCCCAACTGGTACATCAGCAC/TCTGCTCATTCACGAAAAGG
Il6CTACCCCAATTTCCAATGCT/ACCACAGTGAGGAATGTCCA
IfngCCATCAGCAACAACATAAGCGTC/TCTCTTCCCCACCCCGAATCAGCAG
Pde5aGGCAAGCACCATGGAACGAG/TGCGTTGACCATGTCTCTGG
Guca2aTGTCCTGGTAGAAGGGGTCA/CGGGGAGCAAACTTCTTGTG
Guca2bTGGAAGCCATGGTACTTGATG/AAGCGAGGCCATGTCAAGAA
Prkg1GATGGCCCAGAGTTTCACAT/ACCATGGGTCCTGGAAAAGT
Prkg2GGGCATCTGTGATGAGCTTT/CAACCACCCGAACCTATGAC
Gucy2cACCGACAGTGGAGAACCAAC/TCTTATAGCTGGCCACCCGA